bgl ii bam hi fragment (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
97
Structured Review
TaKaRa
bgl ii bam hi fragment
Bgl Ii Bam Hi Fragment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 3916 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bam+hi+bgl+ii+fragment/Bgl+II/pmc06492720-60-4-16
Average 97 stars, based on 3916 article reviews
Bgl Ii Bam Hi Fragment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 3916 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bam+hi+bgl+ii+fragment/Bgl+II/pmc06492720-60-4-16
Average 97 stars, based on 3916 article reviews
bgl ii bam hi fragment - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Macrophage Plasma Membrane Cholesterol Contributes to Brucella abortus Infection of Mice Article Snippet: .. Plasmid pMAW114, which encodes green fluorescence protein (GFP), was constructed by cloning the Fluorescence:Article Title: Macrophage Plasma Membrane Cholesterol Contributes to Brucella abortus Infection of Mice Article Snippet: .. Plasmid pMAW114, which encodes green fluorescence protein (GFP), was constructed by cloning the Construct:Article Title: Macrophage Plasma Membrane Cholesterol Contributes to Brucella abortus Infection of Mice Article Snippet: .. Plasmid pMAW114, which encodes green fluorescence protein (GFP), was constructed by cloning the Cloning:Article Title: Macrophage Plasma Membrane Cholesterol Contributes to Brucella abortus Infection of Mice Article Snippet: .. Plasmid pMAW114, which encodes green fluorescence protein (GFP), was constructed by cloning the Expressing:Article Title: Macrophage Plasma Membrane Cholesterol Contributes to Brucella abortus Infection of Mice Article Snippet: .. Plasmid pMAW114, which encodes green fluorescence protein (GFP), was constructed by cloning the Clone Assay:Article Title: Stringent and reproducible tetracycline-regulated transgene expression by site-specific insertion at chromosomal loci with pre-characterised induction characteristics Article Snippet: To generate pIN-1, pIRESHyg3 (Clontech) was digested with Xho I/ Nhe I and the IRES-Hyg fragment was cloned into the Xba I/ Sal I site of plox66luc, downstream of the luciferase ORF. .. The gpt ORF was removed from pBSgpt [ ] as a Article Title: Functional Interaction Map of Lyssavirus Phosphoprotein: Identification of the Minimal Transcription Domains Article Snippet: .. First the EGFP gene (Clontech) was amplified with primers FUS-GFP 5′ (5′ CGGGATCCATGGGTAAAGGAGAAGAAC 3′) and FUS-GFP 3′ (5′ GAAGATCTTATTTGTATAGTTCATCCATGCC 3′) and the Article Title: Macrophage Plasma Membrane Cholesterol Contributes to Brucella abortus Infection of Mice Article Snippet: .. Plasmid pMAW114, which encodes green fluorescence protein (GFP), was constructed by cloning the Amplification:Article Title: Functional Interaction Map of Lyssavirus Phosphoprotein: Identification of the Minimal Transcription Domains Article Snippet: .. First the EGFP gene (Clontech) was amplified with primers FUS-GFP 5′ (5′ CGGGATCCATGGGTAAAGGAGAAGAAC 3′) and FUS-GFP 3′ (5′ GAAGATCTTATTTGTATAGTTCATCCATGCC 3′) and the |